Home: Perl Programming Help: Intermediate:
Comparing 2 different-sized strings



AdrianJ217
Novice

Aug 8, 2013, 8:30 AM


Views: 4559
Comparing 2 different-sized strings

Hi,

I'm kind of new to Perl and I am comparing 2 strings of different size containing DNA nucleotides. I want the script to take the smaller string and locate it in the much larger string allowing for mismatches and providing me with the sequence it found in the larger string plus adjacent 5 nucleotides on either side.

So for example if I have 2 strings:

#1 ATGATCCTG
#2 TCGAGTGGCCATGAACGTGCCAATTG

I want the script to take #1 and find the same sequence in #2 which is present but with 2 mismatches, along with 5 nucleotides on either side.

Thank you so much!


BillKSmith
Veteran

Aug 8, 2013, 1:30 PM


Views: 4539
Re: [AdrianJ217] Comparing 2 different-sized strings

Am I missing something? Every substring of the right length matches except for the differences. If that is what you want, take a substring of the right length beginning at each character of the longer string. Count the mismatches in each.
Good Luck,
Bill


Laurent_R
Veteran / Moderator

Aug 8, 2013, 2:45 PM


Views: 4532
Re: [BillKSmith] Comparing 2 different-sized strings

This is crossposted on (at least) :
- Perlmonks: http://www.perlmonks.org/?node_id=1048596
- Devshed: http://forums.devshed.com/perl-programming-6/comparing-2-different-sized-strings-in-perl-949907.html#post2896087
- Stackoverflow: http://stackoverflow.com/questions/18130000/comparing-2-different-sized-strings

Just quoting again from a post by someone else on Perlmonks:


Quote
It is considered polite to inform about crossposting so people not attending both sites do not waste their time hacking a solution to a problem already solved at the other end of the Internet.